fix: update vep wrappers to 8.0.0 to make env installable #1409
Workflow file for this run
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| name: Benchmark | |
| #on: | |
| # push: | |
| # branches: [ master ] | |
| # pull_request: | |
| # branches: [ master ] | |
| # TODO enable | |
| # on: | |
| # schedule: | |
| # - cron: 0 13 * * 1 # every monday at 1PM UTC | |
| jobs: | |
| benchmark-giab: | |
| name: Benchmark GIAB exome | |
| runs-on: ubuntu-latest | |
| steps: | |
| - name: Checkout Code | |
| uses: actions/checkout@v2 | |
| - name: Download benchmark | |
| id: benchmark_download | |
| uses: compsci-commons/qc-benchmark-action@main | |
| with: | |
| task: download | |
| benchmark_name: giab-na12878-exome | |
| - name: Write config | |
| env: | |
| DATA: ${{ steps.benchmark_download.outputs.data }} | |
| run: | | |
| # Read location: $DATA/reads.1.fq and $DATA/reads.2.fq | |
| # Reference genome: $DATA/reference.fa | |
| echo -e "NA12878\t1\t../$DATA/reads.1.fq\t../$DATA/reads.2.fq\t\t-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" >> .test/config-giab/units.tsv | |
| - name: Cache workflow results | |
| id: cache-results | |
| uses: actions/cache@v2 | |
| with: | |
| path: .test/results/final-calls/NA12878.present.fdr-controlled.vcf.gz | |
| key: key-${{ hashFiles('workflow/**') }}-${{ hashFiles('.test/config-giab/**') }} | |
| - name: Run workflow | |
| uses: snakemake/snakemake-github-action@v1.22.0 | |
| if: steps.cache-results.outputs.cache-hit != 'true' | |
| with: | |
| directory: .test | |
| snakefile: workflow/Snakefile | |
| args: "results/final-calls/NA12878.present.fdr-controlled.vcf.gz results/final-calls/NA12878.annotated.bcf --configfile .test/config-giab/config.yaml --use-conda --show-failed-logs --cores 1 --conda-cleanup-pkgs cache --all-temp" | |
| - name: Eval benchmark | |
| uses: compsci-commons/qc-benchmark-action@main | |
| id: benchmark_eval | |
| with: | |
| task: eval | |
| benchmark_name: giab-na12878-exome | |
| results-path: .test/results/final-calls/NA12878.present.fdr-controlled.vcf.gz | |
| - name: Show results | |
| env: | |
| REPORT: ${{ steps.benchmark_eval.outputs.report }} | |
| run: | | |
| cat $REPORT.summary.csv | |
| - name: Upload all calls as artifact | |
| uses: actions/upload-artifact@v2 | |
| with: | |
| name: benchmark-all-calls | |
| path: .test/results/final-calls/NA12878.annotated.bcf | |
| - name: Upload filtered calls as artifact | |
| uses: actions/upload-artifact@v2 | |
| with: | |
| name: benchmark-filtered-calls | |
| path: .test/results/final-calls/NA12878.present.fdr-controlled.vcf.gz | |
| - name: Upload report as artifact | |
| uses: actions/upload-artifact@v2 | |
| with: | |
| name: benchmark-report | |
| path: ${{ steps.benchmark_eval.outputs.report }}.* |